Review



lentiviral vectors encoding guide rna targeting human cd74  (GenScript corporation)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    GenScript corporation lentiviral vectors encoding guide rna targeting human cd74
    Lentiviral Vectors Encoding Guide Rna Targeting Human Cd74, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+encoding+guide+rna+targeting+human+cd74/lentiviral+vectors+encoding+guide+rna+targeting+human+cd74/10__1158_slash_0008___5472__can___20___2811-98-12-14
    Average 90 stars, based on 1 article reviews
    lentiviral vectors encoding guide rna targeting human cd74 - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Plasmid Preparation:

    Article Title: Single-Cell Analyses Reveal Diverse Mechanisms of Resistance to EGFR Tyrosine Kinase Inhibitors in Lung Cancer
    Article Snippet: .. Briefly, HEK293T cells were cotransfected with lentiviral vectors encoding guide RNA targeting human CD74 (Genscript; ATGCAGAATGCCACCAAGTA) or lentiCRISPRv2 backbone vectors (Addgene, #52961) and pCMV-dR8.91 (a gift of Dr. Bob Weinberg; Addgene plasmid #8455; http://n2t.net/addgene:8455; RRID:Addgene_8455) and pMD2.G (a gift of Dr. Didier Trono; Addgene plasmid #12259; http://n2t.net/addgene:12259; RRID: Addgene_12259) using the TransIT-X2 Dynamics Delivery System. .. H1975 cells were then infected as described above, followed by selection in 3 mg/mL puromycin (Thermo Fisher Scientific, #AAJ672368EQ) to obtain targeted gene knockout cells.



    Similar Products

    lentiviral vectors encoding guide rna targeting human cd74  (GenScript corporation)
    90
    GenScript corporation lentiviral vectors encoding guide rna targeting human cd74
    Lentiviral Vectors Encoding Guide Rna Targeting Human Cd74, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/lentiviral+vectors+encoding+guide+rna+targeting+human+cd74/lentiviral+vectors+encoding+guide+rna+targeting+human+cd74/10__1158_slash_0008___5472__can___20___2811-98-12-14
    Average 90 stars, based on 1 article reviews
    lentiviral vectors encoding guide rna targeting human cd74 - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results